First Detection of Ehrlichia canis in Cerebrospinal Fluid From a Nonthrombocytopenic Dog with Meningoencephalitis By Broad‐Range PCR

A 10-year-old, 4.4 kg, intact female poodle presented with clinical signs of weakness in both hind limbs in May 2013 at the Veterinary Teaching Hospital, Kasetsart University, Bangkok, Thailand. The dog had a mild fever (39.5°C) and demonstrated hyperesthesia in the lumbar area. Radiographic imaging showed normal appearance of the spine and intervertebral disk spaces. A CBC was within reference ranges. An antipyretic drug, tolfenamic acid, was administered once SC (4 mg/ kg), combined with an analgesic drug, tramadol, administered PO (3 mg/kg). The mild fever improved within 24 hours, but the dog still had signs of weakness in the hind limbs and hyperesthesia in the lumbar area. Intervertebral disk disease at the lumbo-sacral area initially was diagnosed, and anti-inflammatory doses of a corticosteroid were given for 7 days, after which the clinical signs of weakness in both hind limbs had slightly improved. A month after treatment, in June 2013, there were no signs of hind limb weakness, but recurrence of the same clinical signs occurred for 3 months from June to August 2013, and intermittent 7-day courses of a corticosteroid were prescribed at subsequent monthly reevaluations. On 10th September 2013, the dog was hospitalized with clinical signs of hyperesthesia along the vertebral column and neurologic deficits, including disoriented mental status, unilateral palpebral reflex deficit, and vestibular and cerebellar ataxia. These findings suggested multifocal brain lesions with progressive loss of neurologic functions. A CBC disclosed leukocytosis (26 000 cells/lL) with left shift and mild anemia (hematocrit, 26.8%). Platelet numbers and other blood biochemistry results were normal. Infectious encephalitis was suspected based on the clinical signs and leukocytosis. A sample of cerebrospinal fluid (CSF) was submitted to the diagnostic laboratory for standard bacterial culture and cytologic examination. The results of CSF culture for bacteria using standard techniques were negative. Subsequently, a broad-range nested PCR targeting the 16S rRNA gene was performed to confirm bacterial meningoencephalitis. The dog was treated with amoxicillin/clavulanic acid (30 mg/kg, PO q12h), dexamethasone (0.05 mg/kg, PO q12h), dimenhydrinate (8 mg/kg, PO q12h), and vitamin B. DNA was extracted from the CSF sample for the PCR using a DNA extraction Kit according to the manufacturer’s instructions. A previous study described conserved sequences of the 16S rRNA gene of bacteria that were used for the next-generation DNA sequencing (pyrosequencing). In the current study, we modified these regions to develop the PCR primers for our novel nested PCR, targeting the 16S rRNA gene (16S rDNA). The analytical sensitivity of the nested broad-range PCR was determined by testing 10 serial 10-fold dilutions of DNA extracted from Escherichia coli, Staphylococcus spp., Streptococcus spp., Pseudomonas spp., Klebsiella spp., and Proteus spp. The dilutions used ranged from 10–10 3 bacterial colony-forming units (CFU/mL) and the concentration of DNA extracted from each dilution was measured by spectrophotometer. The lowest dilution detected by the PCR was 10 3 CFU/mL from all bacteria analyzed in this study. DNA concentrations of the lowest dilution (10 3 CFU/mL) ranged from 0.5–1.9 ng/lL. The 16S rDNA primers for the primary PCR consisted of V1-F (50 AGAGTTTGATCCTGGCTCAG 30) and V9-R (50 GNTACCTTGTTACGACTT 30). The reaction for the primary PCR was performed using 1 lL of DNA in a 25 lL reaction containing 19 PCR buffer, 2 mM From the Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand (Kaewmongkol, Maneesaay, Suwanna, Sirinarumitr, Jittapalapong); the Neurological Clinic, Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand (Tiraphut, Krajarngjang, Chouybumrung); the Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand (Kaewmongkol); and the Department of Infectious Disease and Global Health, Cummings School of Veterinary Medicine, Tufts University, Boston, MA (Fenwick). Corresponding author: Gunn Kaewmongkol, Faculty of Veterinary Medicine, Kasetsart University, 50 Ngam Wong Wan Rd., Ladyaow Chatuchak 10900, Bangkok, Thailand; e-mails: gunn_kaew@ yahoo.com and [email protected]. Submitted April 1, 2015; Revised September 1, 2015; Accepted October 13, 2015. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. DOI: 10.1111/jvim.13788 Abbreviations: